View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8941_low_64 (Length: 219)
Name: NF8941_low_64
Description: NF8941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8941_low_64 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 10558180 - 10558371
Alignment:
| Q |
19 |
atttgctaccaactcttcattgccatcctgaacaacctcgaccacttctcgagctccaaa-agagacttaaccagtgcgctccaaccattaataaatata |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10558180 |
atttgctaccaactcttcatagccatcctgaacaacctcgagcacttctcgagctccaaatagagacttaaccagtgcgctccaaccattaataaatata |
10558279 |
T |
|
| Q |
118 |
tttatttgtatgtt-ttatatacctcaatacttttttgtaagagtttgatgtttaaattgtggattgcttcttggtttgtatgagtttgatgt |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10558280 |
tttatttgtatgtaattatatacctcaatacttttt-gtatgagtttgatgtttaaattgtggattgcttcttggtttgtatgagtttgatgt |
10558371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University