View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8941_low_71 (Length: 211)
Name: NF8941_low_71
Description: NF8941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8941_low_71 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 37244600 - 37244546
Alignment:
| Q |
19 |
attaaaccttcagaatttaggggtagatgtgagcattttccatcattcttaattg |
73 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37244600 |
attaaacctttggaatttaggggtagatgtgagcattttccatcattcttaattg |
37244546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 211
Target Start/End: Complemental strand, 37244405 - 37244348
Alignment:
| Q |
155 |
cattttgtta-aaatattggtggatgtcaaagacattttattatacatataattataa |
211 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37244405 |
cattttgttataaatattagtcgatgtcaaagacattttattatacatataattataa |
37244348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University