View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8943_high_6 (Length: 244)
Name: NF8943_high_6
Description: NF8943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8943_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 5593364 - 5593567
Alignment:
| Q |
1 |
tatagttgaaggaggagagagaaagagaaaggataattatggaaataaaatttaaggaactaactgtaaggacaacaaccactattatattannnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5593364 |
tatagttgaaggaggagagagaaagataaaggataattatggaaataaaatttatggaactaactgtaaggacaacaaccactattatattatttttttt |
5593463 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnnnnggcttcactgtaatgttaatgtactttcacagatggttgcgtgctcttactcttttaccactttctttcctcaattgccccta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5593464 |
tctttttacttttctttggcttcactgtaatgttaatgtactttcacagatggttgcgtgctcttactcttttaccactttctttcctcaattgccccta |
5593563 |
T |
 |
| Q |
201 |
cccg |
204 |
Q |
| |
|
|||| |
|
|
| T |
5593564 |
cccg |
5593567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University