View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8943_low_15 (Length: 244)

Name: NF8943_low_15
Description: NF8943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8943_low_15
NF8943_low_15
[»] chr1 (1 HSPs)
chr1 (1-204)||(5593364-5593567)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 5593364 - 5593567
Alignment:
1 tatagttgaaggaggagagagaaagagaaaggataattatggaaataaaatttaaggaactaactgtaaggacaacaaccactattatattannnnnnnn 100  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||            
5593364 tatagttgaaggaggagagagaaagataaaggataattatggaaataaaatttatggaactaactgtaaggacaacaaccactattatattatttttttt 5593463  T
101 nnnnnnnnnnnnnnnnnggcttcactgtaatgttaatgtactttcacagatggttgcgtgctcttactcttttaccactttctttcctcaattgccccta 200  Q
                     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5593464 tctttttacttttctttggcttcactgtaatgttaatgtactttcacagatggttgcgtgctcttactcttttaccactttctttcctcaattgccccta 5593563  T
201 cccg 204  Q
    ||||    
5593564 cccg 5593567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University