View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8943_low_17 (Length: 239)
Name: NF8943_low_17
Description: NF8943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8943_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 27022784 - 27022686
Alignment:
| Q |
1 |
tgcgtcgactttcacttcgaattttgaaattgtttcttcaatttggtagtgaaaaatcattctccatcgcaaatactatctagggttgaattcttgtag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27022784 |
tgcgtcgactttcacttcgaattttgaaattgtttcttcaatttggtagtgaaaaatcattctccatcgcaaatactatctagggttgaattcttgtag |
27022686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 155 - 225
Target Start/End: Complemental strand, 27022630 - 27022560
Alignment:
| Q |
155 |
ctgagagtaaggaattgagaagaatagaatgggtaggaaagaaagaaggagaaggaaatcggatgattctg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27022630 |
ctgagagtaaggaattgagaagaatagaatgggtaggaaagaaagaaggagaaggaaatcggatgattctg |
27022560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University