View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8944_high_3 (Length: 223)
Name: NF8944_high_3
Description: NF8944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8944_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 21353694 - 21353531
Alignment:
| Q |
1 |
ttatgattctgggtctattaatattataatcgacgacgccctgaagatggatggactttcactgtcgaggaaatgggatcaacccgaccactgaatgaga |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21353694 |
ttatgattctgagtctattaatattataatagacgacgccctgaagatggatggactttcactgtcgaggaaatgggatcaacccgaccactgaatgaga |
21353595 |
T |
 |
| Q |
101 |
tggagaaaatttatgtgagacgagagactccacgccggcgacgcaggatccttccttgattaca |
164 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21353594 |
tggagaaaatgtatgtgagacgagagactccacgccggcgacgcaggatccttccttgattaca |
21353531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 35 - 163
Target Start/End: Complemental strand, 31048 - 30920
Alignment:
| Q |
35 |
gacgccctgaagatggatggactttcactgtcgaggaaatgggatcaacccgaccactgaatgagatggagaaaatttatgtgagacgagagactccacg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31048 |
gacgccctgaagatggatggactttcactgtcgaggaaatgggatcaacccgaccactgaatgagatggagaaaatgtatgtgagacgagagactccacg |
30949 |
T |
 |
| Q |
135 |
ccggcgacgcaggatccttccttgattac |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30948 |
ccggcgacgcaggatccttccttgattac |
30920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 76 - 164
Target Start/End: Original strand, 15226189 - 15226277
Alignment:
| Q |
76 |
ggatcaacccgaccactgaatgagatggagaaaatttatgtgagacgagagactccacgccggcgacgcaggatccttccttgattaca |
164 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15226189 |
ggatcaacccgaccactgaatgagatggaaaaaatgtatgtgagacgagagactccacgccggcgacgcaggatccttccttgattaca |
15226277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 25 - 78
Target Start/End: Original strand, 15226081 - 15226134
Alignment:
| Q |
25 |
tataatcgacgacgccctgaagatggatggactttcactgtcgaggaaatggga |
78 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| | ||| |||||||| |
|
|
| T |
15226081 |
tatagtcgacgacgccctgaagatggatggactttcactatagagaaaatggga |
15226134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 30902 - 30869
Alignment:
| Q |
181 |
gactagctgctaagattagaatttgtagtataat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30902 |
gactagctgctaagattagaatttgtagtataat |
30869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University