View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8945_low_2 (Length: 323)
Name: NF8945_low_2
Description: NF8945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8945_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 30954048 - 30953875
Alignment:
| Q |
1 |
aaagatagtactcatacaaaaattattcctaatcttgtaaaaaagtacaaaattattatactcgttgcgctaaatgcattgcttagaaactttcttttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30954048 |
aaagatagtactcatacaaaaattattcctaatcttgtaaaaaagtacaaaataatcatactcgttgcgctaaatgcattgcttagaaactttcttttca |
30953949 |
T |
|
| Q |
101 |
atgtaagtacatttatgtcttcttccccacctcctcaatgtaaggaattactatctctgtgcttcaatatgatt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30953948 |
atgtaagtacatttatgtcttcttccccacctcctcaatgtaaggaattactatctctgtgcttcaatatgatt |
30953875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 182 - 313
Target Start/End: Complemental strand, 30953843 - 30953712
Alignment:
| Q |
182 |
tttctttagaaaaaatatcccaattttatttttaacgtggttttaacaagagttgacagaaaagaaaaacagttaatgcagcttcagtacaagagctagc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30953843 |
tttctttagaaaaaatatcccaattttatttttaacgtggttttaacaagagttgacagaaaagaaaaacagttaatgcagcttcagtacaagagctagc |
30953744 |
T |
|
| Q |
282 |
taatatatgtctgtgcttctccttcacatatt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30953743 |
taatatatgtctgtgcttctccttcacatatt |
30953712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University