View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8945_low_7 (Length: 275)
Name: NF8945_low_7
Description: NF8945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8945_low_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 275
Target Start/End: Complemental strand, 3660074 - 3659804
Alignment:
| Q |
17 |
agaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaatgaggagagcgttcatgat----- |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3660074 |
agaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaatgaggagagcgttcatgatgatga |
3659975 |
T |
 |
| Q |
112 |
-------tatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaatggtgtctttgttcaaaggcaagtaattcaacctaga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3659974 |
tgatgattatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaatggtgtctttgttcaaaggcaagtaattcaacctaga |
3659875 |
T |
 |
| Q |
205 |
gtgaagaagagtgtgagatttgcagagaatggtaatgtttgtgagacttatagcacaagaactggtgaatc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
3659874 |
gtgaagaagagtgtgagatttgcagagaatggtaatgtttgtgaggtttatagcacaagaacttgtgaatc |
3659804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University