View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8945_low_8 (Length: 236)
Name: NF8945_low_8
Description: NF8945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8945_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 8792381 - 8792254
Alignment:
| Q |
96 |
taatagatccctcataatatatcttcaatttttagtagaaaatgaaattgttattaatgtgttttgcttcnnnnnnnnnnnnnatgtgaaggttgctgcc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8792381 |
taatagatccctcataatatatcttcaattttttgtagaaaatgaaattgttattaatgtgttttgcttcttttttattttttatgtgaaggttgctgcc |
8792282 |
T |
|
| Q |
196 |
caacctatgacaaagcgcaagggaaagg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8792281 |
caacctatgacaaagcgcaagggaaagg |
8792254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 8792476 - 8792443
Alignment:
| Q |
1 |
ttacatatgttttaatatatctatagttatcttg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8792476 |
ttacatatgttttaatatatctatagttatcttg |
8792443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University