View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8946_high_5 (Length: 260)
Name: NF8946_high_5
Description: NF8946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8946_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 54 - 242
Target Start/End: Original strand, 52608960 - 52609146
Alignment:
| Q |
54 |
tatgctgcgagtgaattacgataaaatagtagttatactgttccggtaaaacaaaagagatattattcttaagatccaatctcagacatggttggaagaa |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52608960 |
tatgctgcgagtgaattacgataaaatagtagatatactgttccggtaaaacaaaagagatattattcttaagatccaatctcagacatagttggaagaa |
52609059 |
T |
 |
| Q |
154 |
aaggccgaagtggatgctaggaagttgatgtggttgttgacgacagcggttcttcatgggtgtgggggatgtaccaacaaagacattcc |
242 |
Q |
| |
|
| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52609060 |
acggccgaagtgggtgctaggaagttgatgtggttgttgacgacagcggttcttcatgggtgt--gggatgtaccaacaaagacattcc |
52609146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 52608898 - 52608937
Alignment:
| Q |
18 |
acatctgtgtttttgttttgcattgtacatatgttttatg |
57 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52608898 |
acatctgtgtttttgttttacattgtacatatgttttatg |
52608937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University