View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8946_low_11 (Length: 280)
Name: NF8946_low_11
Description: NF8946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8946_low_11 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 11 - 280
Target Start/End: Original strand, 32373648 - 32373917
Alignment:
| Q |
11 |
cagagaataaagatatcaatgcctcgattgcaaggtcataagtttcgggatgtctccatgcaactgataacaaattcaatactgatttccatccgacttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373648 |
cagagaataaagatatcaatgcctcgattgcgaggtcataagtttcgggatgtctccatgcaactgataacaaattcaatactgatttccatccgacttg |
32373747 |
T |
|
| Q |
111 |
agtctgtaaatttgcagggtattggatgactattttgctcatcagttgcgctataatctcgtaacacatgtcgagtatttctttatcgagtttccacatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373748 |
agtctgtaaatttgcagggtattggatgactattttgctcatcaattgcgctataatctcgtaacacatgtcgagtatttctttatcgagtttccacatc |
32373847 |
T |
|
| Q |
211 |
aatgttatggatttgaaaataagttcctcagcaagtttgtcttctcttggtgttgaaaagagtttgagac |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373848 |
aatgttatggatttgaaaataagttcctcagcaagtttgtcttctcttggtgttgaaaagagtttgagac |
32373917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University