View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8946_low_17 (Length: 250)
Name: NF8946_low_17
Description: NF8946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8946_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 5931063 - 5930844
Alignment:
| Q |
1 |
cattgttcatatgaggacctctttgatatgtggtttgtaagtaccttatatcgctcttttagtctccaacaaacgtagtcggtctcggtcctagtttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5931063 |
cattgttcatatgaggacctctttgatatgtggttt-------------atcgctcttttagtctccaacaaacgtagtcgatctcggtcctagtttatt |
5930977 |
T |
 |
| Q |
101 |
ttttcttgatcctttcaagtggttgtatggacatgtgcgaatctcgaccgttcaaatacccttggatagtatgtgataacattaacgagtggttgagatc |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5930976 |
ttttcttgatcctttcaagtggttgcatggacatgtgcgaatctcgaccgttcaaatacccttggatagtatgtgataacattaacgagtggttgagatc |
5930877 |
T |
 |
| Q |
201 |
aatgcagaacaagcaacatgtcaaaaagggttg |
233 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |
|
|
| T |
5930876 |
aatgcagaacaaaaaacatgtcaaaaagggttg |
5930844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University