View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8946_low_20 (Length: 241)
Name: NF8946_low_20
Description: NF8946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8946_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 38412546 - 38412777
Alignment:
| Q |
18 |
agcaataaactgattttaacaaagatataagaaatcacccatgtagcatcggtgtttgacacaaacacacatgtgtccaactcttcataggaaataacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38412546 |
agcaataaactgattttaacaaagagataagaaatcacccatgtagcatcggtgtttgacacaaacacacatgtgtccaactcttcataggaaataacaa |
38412645 |
T |
 |
| Q |
118 |
aacatatatggaacc---------------------ttaaggattaatataaaaatccaaacctagcagcaagtaagt-aattacgagatggaaatgaat |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38412646 |
aacatatatggaaccttaatctttcaaaaaaaaaaattaaggattaatataaaaatccaaacctagcagcaagtaagtaaattacgagatggaaatgaat |
38412745 |
T |
 |
| Q |
196 |
ttaattgcaacatcattcatctcatccatcca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38412746 |
ttaattgcaacatcattcatctcatccatcca |
38412777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University