View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8946_low_24 (Length: 228)
Name: NF8946_low_24
Description: NF8946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8946_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 11722815 - 11723015
Alignment:
| Q |
18 |
tgttccacctccatcattggaaaatctgtgtgttgagtatctcaaataacatccagcattcaaaaccctaccttcactatttggcaaacaccctctaacc |
117 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11722815 |
tgttccacctccatctttgaaaaatttgtgtgttgagtatctcaaataacatccagcattcaaaaccctaccttcactatttggcaaacaccctctaacc |
11722914 |
T |
 |
| Q |
118 |
ttcttcacagcattgttcaaacaatctctacacccatcaatcccaagagttttccagcattgtgctaaggcataaacaccctcaacttctccaacaccaa |
217 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
11722915 |
ttcttaacagcattgctcaaacaatctctacacccatcaatcccaagagttttccagcattgtgctaaggcataaacaccctcaacctctccaacagcaa |
11723014 |
T |
 |
| Q |
218 |
a |
218 |
Q |
| |
|
| |
|
|
| T |
11723015 |
a |
11723015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University