View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8948_low_7 (Length: 244)
Name: NF8948_low_7
Description: NF8948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8948_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 103 - 232
Target Start/End: Complemental strand, 3473986 - 3473858
Alignment:
| Q |
103 |
gacagatcttaggtggcaactgaagtacgtggaaaatagagatttgagcttcagatggagcctctatggggtcgatctcaatgagtcttactattacatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
3473986 |
gacagatcttaggtggcaactgaagtacgtgaaaaatagagatttgagcttcaggtggagcctctct-gggtcgatctcaataagtcttactattacatt |
3473888 |
T |
 |
| Q |
203 |
ttaaatcatttgaaatgcgtagataattac |
232 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
3473887 |
ttaaatcatttgaaacgcgtagataattac |
3473858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University