View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8949_high_21 (Length: 253)
Name: NF8949_high_21
Description: NF8949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8949_high_21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 76 - 253
Target Start/End: Complemental strand, 29785286 - 29785091
Alignment:
| Q |
76 |
gtgtgaaatgatcaaatatgtcgattattatgggacagattgagcatgttatttaatttt------------------gtttaactgatcaatttgttat |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29785286 |
gtgtgaaatgatcaaatatgtcaattattatgggacagattgagcatgttatttaattttcattgttaatttaattttgtttaactgatcaatttgttat |
29785187 |
T |
 |
| Q |
158 |
gttatttgattattaaatgaacagaaacaagctgatgtaaattcattgcttctgttgctgggattgctatgccatttgctgccattgatgttcaag |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29785186 |
gttatttgattattaaatgaacagaaacaagctgatgtaaattcattgcttctgttgctgggattgctatgccatttgctgccattgatgttcaag |
29785091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 126 - 242
Target Start/End: Complemental strand, 21907144 - 21907028
Alignment:
| Q |
126 |
atttaattttgtttaactgatcaatttgttatgttatttgattattaaatgaacagaaacaagctgatgtaaattcattgcttctgttgctgggattgct |
225 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
21907144 |
atttaattttgtttaaccaatcaatttgttttgttatttgattattaaatgaacagaaacaagcagatgtaaattcattgcttttgttgctgggattgct |
21907045 |
T |
 |
| Q |
226 |
atgccatttgctgccat |
242 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21907044 |
atgccatttgctgccat |
21907028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 92 - 129
Target Start/End: Complemental strand, 21907196 - 21907159
Alignment:
| Q |
92 |
tatgtcgattattatgggacagattgagcatgttattt |
129 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21907196 |
tatgtcgattattgtgggacagattgagcatgttattt |
21907159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University