View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8949_high_22 (Length: 239)
Name: NF8949_high_22
Description: NF8949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8949_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 80 - 195
Target Start/End: Complemental strand, 43476838 - 43476724
Alignment:
| Q |
80 |
catgataagtccaagttttgaacctaaaccatcggtatataagtcttcctatcatcttgactaacaattatagttacaaagaaaactatg-ttttttcca |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
43476838 |
catgataagtccaagttttgaacctaaaccatcggtatataagtcttccgatcatcttgactaacaattatagttacaaagaaa--tatgtttttttcca |
43476741 |
T |
 |
| Q |
179 |
taggcgcgaccccttat |
195 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43476740 |
taggcgcgaccccttat |
43476724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University