View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8949_low_33 (Length: 372)
Name: NF8949_low_33
Description: NF8949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8949_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 22 - 356
Target Start/End: Complemental strand, 12271337 - 12271003
Alignment:
| Q |
22 |
ttcattccaatgaagccttatttgttttctcttttaaccattttaacagagagattatcagtacaaccaactctgaggtcttttgcttaagaagcgcatc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12271337 |
ttcattccaatgaagccttatttgttttctcttttaaccattttaacagagagattatcagtacaaccaactctgaggtcttttgcttaagaagtgcatc |
12271238 |
T |
 |
| Q |
122 |
cttgccaagatgtcggagacaaagaatcaagctttattttagcttgtgctcagggacaacaaatgaatagattccttcatcctcaagaattgcatgatgc |
221 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12271237 |
cttgccaggatgtcggagacaaagaatcaagctttattttagcttgtgctcagggacaacaaatgaatagattccttcatcctcaagaattgcatgatgc |
12271138 |
T |
 |
| Q |
222 |
agtacgacaaggcctgattggtttagtctaaccatactttaccgcgtattgcagttgggggaatttctcaaagatgtgactccttttctatattttcaac |
321 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12271137 |
agtacgacaaggcctaattggtttagtctaaccatactttaccgcgtattgcagttgggggaatttctcaaagatgtgactccttttctatattttcaac |
12271038 |
T |
 |
| Q |
322 |
taacactgaacttttgtttcttaaaagctgcaaat |
356 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||| |
|
|
| T |
12271037 |
taacacagaacttttgtttcttaaaaactgcaaat |
12271003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University