View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8949_low_43 (Length: 304)
Name: NF8949_low_43
Description: NF8949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8949_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 8023070 - 8022785
Alignment:
| Q |
1 |
cagatctagctgccacatgggttactatttaatgcaattgttaaattcaatattccaaaagtcaattttctctattagtatatcctaatcacattgcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8023070 |
cagatctagctgccacatgggttactatttaatgcaattgttaaattcaatattccaaaagtcaattttctctattagtatatcctaatcacattgcatc |
8022971 |
T |
|
| Q |
101 |
acccttataaatatcaaaaacttcccacccctataattctctcacgtcattccatttgtacaaacacttcaacattaacatatgtatcttcatcttctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022970 |
acccttataaatatcaaaaacttcccacccctataattctctcacgtcattccatttgtacaaacacttcaacattaacatatgtatcttcatcttctta |
8022871 |
T |
|
| Q |
201 |
cacacatagaattttttgatattgtccctacttttttgtttgttcctcctgatgactgattctgcagctattaggtttcttcgacg |
286 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022870 |
cacacatagaattttttgatattgttcctacttttttgtttgtccctcctgatgactgattctgcagctattaggtttcttcgacg |
8022785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University