View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8949_low_44 (Length: 302)
Name: NF8949_low_44
Description: NF8949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8949_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 19 - 289
Target Start/End: Complemental strand, 41989381 - 41989111
Alignment:
| Q |
19 |
agttggtggcggtgtagaacggaagaaggagaatgatgttgttgttcgaatggaannnnnnnnnnnnnnnnnnn---caggagaagaggagatagctgca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41989381 |
agttggtggcggtgtagaacggaagaaggagaatgatgttgttgttcgaatggaagatgatgatgatgatgatgatgcaggagaagaggagatagctgca |
41989282 |
T |
 |
| Q |
116 |
tagagcggagtttgcaatgttgctgccatttctggattttcagagataaacacgatgctagctttccgacactatagacttggttagaaattaagagctg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41989281 |
tagagcggagtttgcaatgttgctgccatttctggattttcagagataaacacgatgctagctttcagacactatagacttggttagaaattaagagctg |
41989182 |
T |
 |
| Q |
216 |
gcgttaatgaattagcgataaataatcaatttttatcaacttatcttaatactaataatttaagtttatcttct |
289 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
41989181 |
gcattaatgaattagccataaataatcaatttttatcaactgatcttga---taataatttaagtttatcttct |
41989111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University