View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8949_low_45 (Length: 279)
Name: NF8949_low_45
Description: NF8949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8949_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 7228520 - 7228249
Alignment:
| Q |
1 |
tatatgcgttgggatgaactaaagttataagctcgggacaatgtcaaagtacttaatacatatagttgagcgctctacgaaacttgaggttttttcgaat |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||||||| ||||| || |||||||| |
|
|
| T |
7228520 |
tatatgtgttgggatgaactaaagttataagctcggtacaatgtcaaagtacttaatatgtatagtcaagcgctctacgaaatttgagattctttcgaat |
7228421 |
T |
 |
| Q |
101 |
cctattaaaactaggagttagggtttagggtttcaacttggagtt-ttttctaatcctggaactcaacttgtgtaaacatttggcgacaaagaaaatatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
7228420 |
tttattaaaactaggagttagggtttagggtttcaacttggagtttttttctaatcctgggtctcaacttgtgtaaacatttcgtgacaaagaaaatatt |
7228321 |
T |
 |
| Q |
200 |
ataatctatgatcggtccatattggctattgatgtcatttcatatcgatctttcaatttcatccagtataat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
7228320 |
ataatctatgatcggtccatattggctattgatgtcatttcatgtcgatctttcaatttcatccagtgtaat |
7228249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University