View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8949_low_58 (Length: 213)
Name: NF8949_low_58
Description: NF8949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8949_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 29 - 203
Target Start/End: Complemental strand, 37046044 - 37045866
Alignment:
| Q |
29 |
caattttatttttgtacctttaaaatgaaatgaataaatggttgggaggtggacatgcaatggaaggaaggaaggacgactacaaa--------gttaag |
120 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
37046044 |
caattttatttttgtacctttaaaacgaaatgaataaatggttgggaggtggacatgcaatggaaggaagga----cgactagaaattgaagtagttaag |
37045949 |
T |
 |
| Q |
121 |
attggaatagcnnnnnnnaaatcgtccaatgatatgccaccatttgttgtactgtgtgcgatgaatgcggcagtcggtctctg |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37045948 |
attggaatagctttttttaaatcgtccaatgatatgccaccatttgttgtactgtgtgcgatgaatgcggcagtcggtctctg |
37045866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University