View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8949_low_60 (Length: 210)
Name: NF8949_low_60
Description: NF8949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8949_low_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 192
Target Start/End: Complemental strand, 34645702 - 34645525
Alignment:
| Q |
15 |
agaagaagaggccaaagattcaaatgcaccaccaaacctttggaatctagtcactgtccatagagttgaggaactgaaagctatcattagaatgcttcca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34645702 |
agaagaagaggccaaagattcaaatgcaccaccaaacctttggaatttagtcactgtccatagagttgaggaactgaaagctatcatcagaatgcttcca |
34645603 |
T |
|
| Q |
115 |
atttgggcttcaggaattttgctcataatgtcttcatcacatttaggtagttttgtcattcaacaagctcgttcgatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34645602 |
atttgggcttcaggaattttgctcataatgtcttcatcacatttaggtagttttgtcattcaacaagctcgttcgatg |
34645525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 35 - 134
Target Start/End: Complemental strand, 34658709 - 34658610
Alignment:
| Q |
35 |
caaatgcaccaccaaacctttggaatctagtcactgtccatagagttgaggaactgaaagctatcattagaatgcttccaatttgggcttcaggaatttt |
134 |
Q |
| |
|
||||||||||| ||||| ||||||| ||| ||||||||||||||||||||| | ||| | ||||| ||||| |||||||||| || ||||||||||| |
|
|
| T |
34658709 |
caaatgcaccatcaaacttttggaaattagccactgtccatagagttgaggagttaaaatccatcatcagaatccttccaatttcagcatcaggaatttt |
34658610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 101 - 142
Target Start/End: Complemental strand, 34665316 - 34665275
Alignment:
| Q |
101 |
ttagaatgcttccaatttgggcttcaggaattttgctcataa |
142 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | ||||||| |
|
|
| T |
34665316 |
ttagaatgcttccaatttgggcatcaggaattctactcataa |
34665275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University