View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8950_high_10 (Length: 553)
Name: NF8950_high_10
Description: NF8950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8950_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 353; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 145 - 537
Target Start/End: Original strand, 3423895 - 3424286
Alignment:
| Q |
145 |
ggaacattgaaggattaaggttaacataattactttcaagcgtgaacggagagtagtgaagttggtagcggtttggatcggtgtccttcaataacggcct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423895 |
ggaacattgaaggattaaggttaacataattactttccagcgtgaacggagagtagtgaagttggtagcggtttggatcggtgtccttcaataacggcct |
3423994 |
T |
 |
| Q |
245 |
tctcttctccttatcataagtcatcaatgcaaccttcactaattggccaacggtatcttcaggcaacatcaaaacttgtattgcacccaacgtgttctcg |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423995 |
tctcttctccttatcataagtcatcaatgcaaccttcactaattggccaacggtatcttcaggcaacatcaaaacttgtattgcacccaacgtgttctcg |
3424094 |
T |
 |
| Q |
345 |
atggacacgttgagtagaagtttcgatggcctaagaagagagtcattggattccgttgtatccaacggaaatttgtctgtttgaggagtagaaacggtac |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3424095 |
atggacacgttgagtagaagtttcgatggcctaagaagagagtcattggattccgttgtatccaacggaaatttgtctgtttgaggagtagaaacggtac |
3424194 |
T |
 |
| Q |
445 |
cacccatgaaggcaaag---aagagagtttggatttcagtttacggcttttttcacaattttgctgttgttgtttgttacgagaaaggtggttttt |
537 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
3424195 |
cacccatgaaggcaaagacaaagagagtttggatttcagtttacggcttttttcactatgttgctgttg----ttgttacgagaaaggtggttttt |
3424286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 3423751 - 3423826
Alignment:
| Q |
1 |
attaatcgaattcatattgttgttatcgaccagtctaattatacatgaatatgcaacaataaagatctataacatc |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423751 |
attaatcgaattcatattgttgttatcgaccagtctaattatacatgaatatgcaacaataaagatctataacatc |
3423826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University