View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8950_high_46 (Length: 219)
Name: NF8950_high_46
Description: NF8950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8950_high_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 13 - 157
Target Start/End: Complemental strand, 1794825 - 1794681
Alignment:
| Q |
13 |
agagaaaagaaggatgcggctacgatactatttattgttttggtgattccatttccatgtgatgggttcatgccatggagacttgttttatgagagcttg |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1794825 |
agagaaaagaagggtgcggctacgatactatttattgttttggtgattccatttccatgtaatgggttcatgccatggagacttgttttatgagagcttg |
1794726 |
T |
 |
| Q |
113 |
agcatatatgttctcagaattgtatgttccctttccttaagaaga |
157 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
1794725 |
agcatatatcttctgagaattgtatgttcccttttcttaagaaga |
1794681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 25861937 - 25861972
Alignment:
| Q |
170 |
gtggtggcctgggtttgaactccggaccttacatat |
205 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25861937 |
gtggtggccggggtttgaactccggaccttacatat |
25861972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University