View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8950_low_111 (Length: 219)

Name: NF8950_low_111
Description: NF8950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8950_low_111
NF8950_low_111
[»] chr1 (1 HSPs)
chr1 (13-157)||(1794681-1794825)
[»] chr5 (1 HSPs)
chr5 (170-205)||(25861937-25861972)


Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 13 - 157
Target Start/End: Complemental strand, 1794825 - 1794681
Alignment:
13 agagaaaagaaggatgcggctacgatactatttattgttttggtgattccatttccatgtgatgggttcatgccatggagacttgttttatgagagcttg 112  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
1794825 agagaaaagaagggtgcggctacgatactatttattgttttggtgattccatttccatgtaatgggttcatgccatggagacttgttttatgagagcttg 1794726  T
113 agcatatatgttctcagaattgtatgttccctttccttaagaaga 157  Q
    ||||||||| |||| ||||||||||||||||||| ||||||||||    
1794725 agcatatatcttctgagaattgtatgttcccttttcttaagaaga 1794681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Original strand, 25861937 - 25861972
Alignment:
170 gtggtggcctgggtttgaactccggaccttacatat 205  Q
    ||||||||| ||||||||||||||||||||||||||    
25861937 gtggtggccggggtttgaactccggaccttacatat 25861972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University