View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8950_low_46 (Length: 386)
Name: NF8950_low_46
Description: NF8950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8950_low_46 |
 |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 2e-43; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 231 - 352
Target Start/End: Original strand, 28177991 - 28178112
Alignment:
| Q |
231 |
tatgtttcaatgcacttcaatttgtagcaaaatgaattttgaaaggaatcagtgctttaaaattgttaaaattctttaaaattgtgaaattgcactctta |
330 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||| |||| ||| |
|
|
| T |
28177991 |
tatgtttcaattcacttcaatttgtagcaaaatgaattttgaagtgaatcattgctttaaaattgttaaatttctttaaaattgtgaaattacactttta |
28178090 |
T |
 |
| Q |
331 |
tatgatgagtgatgaccttaca |
352 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
28178091 |
tatgatgagttatgaccttaca |
28178112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 255 - 345
Target Start/End: Original strand, 28221052 - 28221142
Alignment:
| Q |
255 |
tagcaaaatgaattttgaaaggaatcagtgctttaaaattgttaaaattctttaaaattgtgaaattgcactcttatatgatgagtgatga |
345 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
28221052 |
tagcaaaatgaatttttaagtgaatcagtgctttaaatttgttaaaattctttaaaattgtgaaattgcacttttatatgattagtgatga |
28221142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 28177798 - 28177870
Alignment:
| Q |
5 |
tggaatttgtgccactctacaacatgaaccaaataatttcaaacattgaacggatccatgcagaggttgcatg |
77 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||| ||| |||||| || |||||||| |||| |
|
|
| T |
28177798 |
tggaatttgagccactctacaatatgaaccaaataatttcaaacaatgatcggatctatacagaggttacatg |
28177870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 309 - 351
Target Start/End: Original strand, 28224176 - 28224218
Alignment:
| Q |
309 |
aaattgtgaaattgcactcttatatgatgagtgatgaccttac |
351 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28224176 |
aaattttgaaattgcacttttatatgatgagtgatgaccttac |
28224218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 255 - 345
Target Start/End: Original strand, 21550 - 21640
Alignment:
| Q |
255 |
tagcaaaatgaattttgaaaggaatcagtgctttaaaattgttaaaattctttaaaattgtgaaattgcactcttatatgatgagtgatga |
345 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
21550 |
tagcaaaatgaatttttaagtgaatcagtgctttaaatttgttaaaattctttaaaattgtgaaattgcacttttatatgattagtgatga |
21640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 309 - 351
Target Start/End: Original strand, 24674 - 24716
Alignment:
| Q |
309 |
aaattgtgaaattgcactcttatatgatgagtgatgaccttac |
351 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24674 |
aaattttgaaattgcacttttatatgatgagtgatgaccttac |
24716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University