View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8950_low_71 (Length: 301)
Name: NF8950_low_71
Description: NF8950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8950_low_71 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 153 - 282
Target Start/End: Original strand, 32213875 - 32214007
Alignment:
| Q |
153 |
gattatattatattggtttcatgaaaagtgaacattattgatgtagacattttcatataacactagtgcgtagtgctta---attagtggacaacataga |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
32213875 |
gattatattatattggtttcatgaaaagtgaacattattgatatagacattttcatataacactagtgcgtagtgcgtagtgcttagtggacaacataga |
32213974 |
T |
|
| Q |
250 |
ttagttgaaattatttacaaaaacatttgaagc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32213975 |
ttagttgaaattatttacaaaaacatttgaagc |
32214007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 75 - 128
Target Start/End: Original strand, 32213632 - 32213685
Alignment:
| Q |
75 |
gtttataacttacggttaatgatattatgagttcaaaataaaaattaaacatag |
128 |
Q |
| |
|
|||||||||| || ||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32213632 |
gtttataactgacagttgatgatactatgagttcaaaataaaaattaaacatag |
32213685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University