View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8950_low_72 (Length: 295)
Name: NF8950_low_72
Description: NF8950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8950_low_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 285
Target Start/End: Complemental strand, 31943194 - 31942920
Alignment:
| Q |
12 |
agaggtccacccaaaaggattagaggaaatcaccaatctcctaatacattggcaagttcttctaatgggattgctatgagggataatgcaacattgttat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31943194 |
agaggtccacccaaaaggattagaggaaatcaccaatctcctagtacattggcaagttcttttaatgggattgctatgagggataatgcaacattgttat |
31943095 |
T |
|
| Q |
112 |
ctcaaattcatttgctggatcaagtaggacaacttggtaattcatggagcaggttcagtcaatcaattatggtgaataacggtaataaccatttagttcc |
211 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31943094 |
ctcaaattcacttgctcgatcaagtaggacaacttggtaattcatggagaaggcccggtcaatcaattatggtgaataacggtaatagccatttagttcc |
31942995 |
T |
|
| Q |
212 |
tgaaaataatttggtgcaacacttttggccaacgcctcatatacaaggtaaagtttaatttt-ttattttgatgt |
285 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
31942994 |
tgaaaacaatttggtgcaacacttttggccaacgcctcatatacaaggtaaaattttattttcttattttgatgt |
31942920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 31952398 - 31952125
Alignment:
| Q |
1 |
tggatgatggcagaggtccacccaaaaggattagaggaaatcaccaatctcctaatacattggcaagttctt------------ctaatgggattgctat |
88 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| | | ||||||| |
|
|
| T |
31952398 |
tggatgatggtagaggtccacccaaaagaattagaggaaatcaccaatctcctaatacattggcaagttcttctatttctccccctaacgaggttgctat |
31952299 |
T |
|
| Q |
89 |
gagggataatgcaacattgttatctcaaattcatttgctggatcaagtaggacaacttggtaattcatggagcaggttcagtcaatcaattatggtgaat |
188 |
Q |
| |
|
| ||| ||||| ||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||| || ||| || ||||||||||| |
|
|
| T |
31952298 |
ggggggtaatgtaacattgccatctcaaattcatttgctcaatcaagtagaacaacttggtaattcatggagtagaccaggtcggtctcttatggtgaat |
31952199 |
T |
|
| Q |
189 |
aacggtaataaccatttagttcctgaaaataatttggtgcaacacttttggccaacgcctcatatacaaggtaa |
262 |
Q |
| |
|
|| | ||||| |||||| |||||||||| |||||||||||||||||| ||||| | ||||||||||||||| |
|
|
| T |
31952198 |
aatgaaaataatcatttaattcctgaaaacaatttggtgcaacactttcaaccaacacttcatatacaaggtaa |
31952125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University