View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8950_low_76 (Length: 293)
Name: NF8950_low_76
Description: NF8950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8950_low_76 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 128 - 279
Target Start/End: Complemental strand, 55852572 - 55852421
Alignment:
| Q |
128 |
gttgttgttgataatgatgaatctctggtttgttttgannnnnnnncttcatatgttcatgaatctcgagcacttctgattttgataaatcttactgttg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55852572 |
gttgttgttgataatgatgaatctctggtttgttttgattttttttcttcatatgttcatgaatctcgagcacttctgattttgataaatcttactgttg |
55852473 |
T |
|
| Q |
228 |
attactcttcattttgatgattttttgttttcctcacgaatcacgatgatgt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55852472 |
attactcttcattttgatgattttttgtttccctcacgaatcacgatgatgt |
55852421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 55852682 - 55852620
Alignment:
| Q |
18 |
atttcaatcctgattttgtgttccatctattgctgtttcaggctctttctttagttcataatc |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55852682 |
atttcaatcctgattttgtgttccatctattgctgtttcaggctctttctttagttcataatc |
55852620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University