View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8950_low_90 (Length: 249)
Name: NF8950_low_90
Description: NF8950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8950_low_90 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 6e-49; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 15 - 129
Target Start/End: Original strand, 7462774 - 7462888
Alignment:
| Q |
15 |
tggcgaggaaactgtcatccccttcccttttctcatatctttttcgtctctaatttatgtacccaattcaaaaccatttcatctctctatcttccttcat |
114 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7462774 |
tggcgaggaaactgtcatcctcttcccctttctcatatcttttccgtctctaatttatgtaccccattcaaaaccatttcatctctctatcttccttcat |
7462873 |
T |
|
| Q |
115 |
gtcagtgtttcttct |
129 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7462874 |
gtcagtgtttcttct |
7462888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 19 - 129
Target Start/End: Complemental strand, 31873520 - 31873412
Alignment:
| Q |
19 |
gaggaaactgtcatccccttcccttttctcatatctttttcgtctctaatttatgtacccaattcaaaaccatttcatctctctatcttccttcatgtca |
118 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||| || || |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31873520 |
gaggaaactgtcatcaccttcc--tttctcatatctttttcgtctctaatttctgccacccattcaaaaccatgtcatctctctatcttccttcatgtca |
31873423 |
T |
|
| Q |
119 |
gtgtttcttct |
129 |
Q |
| |
|
||||||||||| |
|
|
| T |
31873422 |
gtgtttcttct |
31873412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 18768087 - 18768003
Alignment:
| Q |
15 |
tggcgaggaaactgtcatccccttcccttttctcatatctttttcgtctctaatttatgtacccaattcaaaaccatttcatctct |
100 |
Q |
| |
|
||||||||||| ||||||| ||||||| |||||||||||||||||||||||||||| || ||| ||||||||||||||||||||| |
|
|
| T |
18768087 |
tggcgaggaaaatgtcatcaccttcccctttctcatatctttttcgtctctaatttctg-cccccattcaaaaccatttcatctct |
18768003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 18790272 - 18790187
Alignment:
| Q |
15 |
tggcgaggaaactgtcatccccttcccttttctcatatctttttcgtctctaatttatgtacccaattcaaaaccatttcatctct |
100 |
Q |
| |
|
|||| |||||| ||||||| ||||||| |||||||| |||||| ||||||||| || ||| ||| ||| ||||||||||||||||| |
|
|
| T |
18790272 |
tggcaaggaaaatgtcatcaccttcccatttctcatttcttttccgtctctaacttctgtcccccattaaaaaccatttcatctct |
18790187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 15 - 133
Target Start/End: Original strand, 11350242 - 11350360
Alignment:
| Q |
15 |
tggcgaggaaactgtcatccccttcccttttctcatatctttttcgtctctaatttatgtacccaattcaaaaccatttcatctctctatcttccttcat |
114 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| ||||||||||| | |||||||||| ||| || ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11350242 |
tggcgaggaaactgtcatcaccttcccctttatcatatcttttccatctctaatttctgtctcccattcaaaaccatttcatctctttatcttccttcat |
11350341 |
T |
|
| Q |
115 |
gtcagtgtttcttcttgat |
133 |
Q |
| |
|
||||||||| |||| |||| |
|
|
| T |
11350342 |
gtcagtgttccttcatgat |
11350360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 18509183 - 18509268
Alignment:
| Q |
15 |
tggcgaggaaactgtcatccccttcccttttctcatatctttttcgtctctaatttatgtacccaattcaaaaccatttcatctct |
100 |
Q |
| |
|
||||||||||| ||||||| ||||||| ||||||||||||||| | |||||||||| || ||| ||||||||||||||||||||| |
|
|
| T |
18509183 |
tggcgaggaaaatgtcatcaccttcccctttctcatatcttttccttctctaatttctgccccccattcaaaaccatttcatctct |
18509268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University