View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8950_low_94 (Length: 243)
Name: NF8950_low_94
Description: NF8950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8950_low_94 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 229
Target Start/End: Complemental strand, 29376175 - 29375965
Alignment:
| Q |
19 |
aacatcactaagagctaaacgtttattcccattttgatcctcaaacaacccaacatttttgcactcatgtttgcaagagggacaaacactaggacaatag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
29376175 |
aacatcactaagagctaaacgtttattcccattttcatcctcaaacaacccaacatttttgcactcatgtttacaagagggacaaacaataggacaatag |
29376076 |
T |
 |
| Q |
119 |
acaagtttatagccctcaacatatttctcaatcttgaaccaattactgatgctttgtggacccgggttgccaataaaaccatccgttgtaacaaacgatt |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29376075 |
acaagtttatagccctcgacatatttctcaatcttgaaccaattactgatgctttgtggacccgggttgccaataaaaccatccgttgtaacaaacgatt |
29375976 |
T |
 |
| Q |
219 |
ttcccttagaa |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
29375975 |
ttcccttagaa |
29375965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University