View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8951_low_14 (Length: 349)
Name: NF8951_low_14
Description: NF8951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8951_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 18 - 331
Target Start/End: Complemental strand, 39299913 - 39299615
Alignment:
| Q |
18 |
agagagagccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttaccttgatcgtgcacaggttcgtgatagtgcaaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39299913 |
agagagagccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttaccttgatcgtgcacatgttcgtgatagtgcaaatg |
39299814 |
T |
 |
| Q |
118 |
tagcaggaaacagagtaggtggaaaagaagattttggtggttttcgtgatgtgggaaagtttcaaatggaatcaaaaggtttaacagatgatagagaaaa |
217 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39299813 |
tagcaggaaa---------------agaagattttggtggtgttcgtgatgtgggaaagtttcaaatggaatcaaaaggtttaaccgatgatagagaaaa |
39299729 |
T |
 |
| Q |
218 |
acttgatagccgaaccaaagtggtttctggaacaccacatgtgaaagaaatgaacagaggaatgggaacaggacaagttgtggccgagaaaggaagaaaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39299728 |
acttgatagccgaaccaaagtggtttctggaacaccacatgtgaaagaaatgaacagaggaatgggaacaggacaagttgtggcagagaaaggaagaaaa |
39299629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University