View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8951_low_23 (Length: 249)
Name: NF8951_low_23
Description: NF8951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8951_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 2389663 - 2389444
Alignment:
| Q |
16 |
cagtaacatgtatatttcatgtatcttgagaattgagattgttggataacaatgttttatgtactaaattattttattcagcttcgagtttcgcctaagg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389663 |
cagtaacatgtatatttcatgtatcttgagaattgagattgttggatgacaatgttttatgtactaaattattttattcagcttcgagtttcgcctaagg |
2389564 |
T |
 |
| Q |
116 |
gtctgtttggcagcagatggccgtctgaatatgatatctcgcatccggaatgtcaatggcaagcctttcagtttctcctttgcatttcatacatatttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389563 |
gtctgtttggcagcagatggccgtctgaatatgatatctcgcatccggaatgtcaatggcaagcctttcagtttctcctttgcatttcatacatatttct |
2389464 |
T |
 |
| Q |
216 |
ccatatctgatatcaggtct |
235 |
Q |
| |
|
| ||||| |||||||||||| |
|
|
| T |
2389463 |
cgatatccgatatcaggtct |
2389444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University