View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8951_low_5 (Length: 434)
Name: NF8951_low_5
Description: NF8951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8951_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 234 - 353
Target Start/End: Original strand, 43353677 - 43353797
Alignment:
| Q |
234 |
tgaaaacaaacatgagttggatttgatttcattattgagtttatttcca-tgtggctgatagttgaggagaactgatacatacatagacacactaagctg |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43353677 |
tgaaaacaaacatgagttggatttgatttcattattgagtttatttccactgtggctgatagttgaggagaactgatacatacatagacacactaagctg |
43353776 |
T |
|
| Q |
333 |
ctggcacaccccatatgtggc |
353 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43353777 |
ctggcacaccccatatgtggc |
43353797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 312 - 353
Target Start/End: Original strand, 1034470 - 1034511
Alignment:
| Q |
312 |
atacatagacacactaagctgctggcacaccccatatgtggc |
353 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1034470 |
atacatagacacactaagctgctggcacaacccatatgtggc |
1034511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University