View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8952_low_43 (Length: 291)
Name: NF8952_low_43
Description: NF8952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8952_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 36552872 - 36552672
Alignment:
| Q |
14 |
cacttttgaggcaccaaatggtacagatgatggagcagtctgataattataagcaagagctacaaatgatttcttacatctctgacagattgtggccttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36552872 |
cacttttgaggcaccaaatggtacagatgatggggcagtctgataattataagcaagaactacaaatgatttcttacatctctgacagattgtggccttt |
36552773 |
T |
|
| Q |
114 |
ctaaaattatatatgtagacctggaaaatgaaattgcaatgtgtgcaaattgtcatgaattcccaatatgcatttggaacttgatttgctgcaaacacat |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36552772 |
ctaaaatcatatatgtagacctggaaaatgaaattgcaatgtgtgcaaattgtcatgaattcccaatatgcatttggaacttgatttgctgcaaacacat |
36552673 |
T |
|
| Q |
214 |
t |
214 |
Q |
| |
|
| |
|
|
| T |
36552672 |
t |
36552672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 229
Target Start/End: Complemental strand, 36525109 - 36525063
Alignment:
| Q |
183 |
gcatttggaacttgatttgctgcaaacacattcccatttgtgtgatg |
229 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| |||||| |||||| |
|
|
| T |
36525109 |
gcatttggaacttgattttctgcaaatacattcgcatttgagtgatg |
36525063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 65 - 102
Target Start/End: Complemental strand, 36531622 - 36531585
Alignment:
| Q |
65 |
agcaagagctacaaatgatttcttacatctctgacaga |
102 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
36531622 |
agcaagagctacaaatgagttcttacatttctgacaga |
36531585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University