View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8952_low_55 (Length: 225)

Name: NF8952_low_55
Description: NF8952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8952_low_55
NF8952_low_55
[»] chr3 (2 HSPs)
chr3 (13-138)||(25066094-25066219)
chr3 (172-210)||(25066011-25066049)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 25066219 - 25066094
Alignment:
13 ttcactgagtatcaagaagagtaatcagaaatacaatggtagtgcacggatttagatggttgaaccgtgaaccgatattggtattgctaccgttcgatat 112  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
25066219 ttcaccgagcatcaagaagagtaatcagaaatacaatggtagtgcacggatttagatggttgaaccgtgaaccgatattgctattgctaccgttcgatat 25066120  T
113 tttgagtggtttattcatgcttccat 138  Q
    ||||||||||||||||||||||||||    
25066119 tttgagtggtttattcatgcttccat 25066094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 25066049 - 25066011
Alignment:
172 aatttaggtgccaatttatttgggctaattgttcaattt 210  Q
    ||||| |||||||||||||||||||||||||||||||||    
25066049 aatttgggtgccaatttatttgggctaattgttcaattt 25066011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University