View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8952_low_55 (Length: 225)
Name: NF8952_low_55
Description: NF8952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8952_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 25066219 - 25066094
Alignment:
| Q |
13 |
ttcactgagtatcaagaagagtaatcagaaatacaatggtagtgcacggatttagatggttgaaccgtgaaccgatattggtattgctaccgttcgatat |
112 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25066219 |
ttcaccgagcatcaagaagagtaatcagaaatacaatggtagtgcacggatttagatggttgaaccgtgaaccgatattgctattgctaccgttcgatat |
25066120 |
T |
 |
| Q |
113 |
tttgagtggtttattcatgcttccat |
138 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25066119 |
tttgagtggtttattcatgcttccat |
25066094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 25066049 - 25066011
Alignment:
| Q |
172 |
aatttaggtgccaatttatttgggctaattgttcaattt |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25066049 |
aatttgggtgccaatttatttgggctaattgttcaattt |
25066011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University