View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8952_low_58 (Length: 219)

Name: NF8952_low_58
Description: NF8952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8952_low_58
NF8952_low_58
[»] chr7 (2 HSPs)
chr7 (14-73)||(31956366-31956426)
chr7 (159-202)||(31956239-31956282)


Alignment Details
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 31956426 - 31956366
Alignment:
14 ttggtggtgtcaacatagcttggttgatcaattcatttctttgattgcatgt-ttggttca 73  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||    
31956426 ttggtggtgtcaacatagctgggttgatcaattcatttctttgattgcatgtcttggttca 31956366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 159 - 202
Target Start/End: Complemental strand, 31956282 - 31956239
Alignment:
159 caatgactatcttaaaatgtgaatgaagaatgttccaatatttt 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
31956282 caatgactatcttaaaatgtgaatgaagaatgttccaatatttt 31956239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University