View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8952_low_58 (Length: 219)
Name: NF8952_low_58
Description: NF8952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8952_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 31956426 - 31956366
Alignment:
| Q |
14 |
ttggtggtgtcaacatagcttggttgatcaattcatttctttgattgcatgt-ttggttca |
73 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31956426 |
ttggtggtgtcaacatagctgggttgatcaattcatttctttgattgcatgtcttggttca |
31956366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 159 - 202
Target Start/End: Complemental strand, 31956282 - 31956239
Alignment:
| Q |
159 |
caatgactatcttaaaatgtgaatgaagaatgttccaatatttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31956282 |
caatgactatcttaaaatgtgaatgaagaatgttccaatatttt |
31956239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University