View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8952_low_65 (Length: 201)

Name: NF8952_low_65
Description: NF8952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8952_low_65
NF8952_low_65
[»] chr3 (1 HSPs)
chr3 (25-184)||(54023038-54023197)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 25 - 184
Target Start/End: Complemental strand, 54023197 - 54023038
Alignment:
25 gtgttttcaaaggatggattgacaaaaacactttcagaccatccaaagttggtgttggaattcctgttgctgtcaaaaagtctagcgccgatagtctcca 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54023197 gtgttttcaaaggatggattgacaaaaacactttcagaccatccaaagttggtgttggaattcctgttgctgtcaaaaagtctagcgccgatagtctcca 54023098  T
125 aggtttacaagaatggcaggtttgttaactaaaccacgttttttcaaccaaccaatctct 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
54023097 aggtttacaagaatggcaggtttgttaactaaaccacgttttttcaaccaaacaatctct 54023038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University