View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8955_low_10 (Length: 364)
Name: NF8955_low_10
Description: NF8955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8955_low_10 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 15 - 349
Target Start/End: Complemental strand, 52524 - 52190
Alignment:
| Q |
15 |
tggacatccggatcaaaaacttttgctatatgcaagtcactgttgcaaaccaatgatatgatccaaaatggtcaattaccgaaagagcctcgggactgtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52524 |
tggacatccggatcaaaaacttttgctatatgcaagtcactgttgcaaaccaatgatatgatccaaaatggtcaattaccgaaagagcctcgggactgtt |
52425 |
T |
|
| Q |
115 |
ttcttaaatgcttttccttcaagctttagtcgcctatgtgcttctctcagatgcgtcggccgaatcggtccagattccctcctctccttcataattgttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52424 |
ttcttaaatgcttttccttcaagctttagtcgcctatgtgcttctctcagatgcgtcggccgaatcggtccagattccctcctctccttcataattgttc |
52325 |
T |
|
| Q |
215 |
tagctgcaaagacaataactttgactaatggaaacaagacactgcaacatttttacattggaaacactatatgcaggagtatttactatcctattaattt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
52324 |
tagctgcaaagacaataactttgactaatggaaacaagacactgcaacatttttacattggaaacactatgtgcaggagtatttactatcctattcattt |
52225 |
T |
|
| Q |
315 |
gcgattttctaattctaatttatttatattaaaat |
349 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52224 |
gcgcttttctaattctaatttatttatattaaaat |
52190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 89 - 261
Target Start/End: Complemental strand, 17817200 - 17817026
Alignment:
| Q |
89 |
attaccgaaagagcctcgggactgttttcttaaatgcttttccttcaagctttagtcgcctatgtgcttctctcagatgcgtcggccgaatcggtccaga |
188 |
Q |
| |
|
|||||||||||||||||| | |||| | ||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
17817200 |
attaccgaaagagcctcgaggttgttcttttaaagatttttccttcaagctttagtcgtctatgtgcttctctcagatggcagggccgaattggtccagt |
17817101 |
T |
|
| Q |
189 |
ttccctcctctccttcataattgttctagctgcaaag--acaataactttgactaatggaaacaagacactgcaa |
261 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||| | | ||||||||| ||||||||||| ||||||||| |
|
|
| T |
17817100 |
ttccttcctctctttcataattgttctagctgcaaagatagagtaactttgattaatggaaacagtacactgcaa |
17817026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University