View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8955_low_28 (Length: 223)
Name: NF8955_low_28
Description: NF8955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8955_low_28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 50743267 - 50743489
Alignment:
| Q |
1 |
agaagttctgttcaaggaggcgttcgttcttctgcaagtaacacaaggagtgagcgtaaaataaaaccgaaggccaaaccaaaggcagctcaactgtcta |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50743267 |
agaagttctgttcaaagaggcgttcgttcttctgcaagtaacacaaggagtgagtgtaaaataaaaccgaaggccaaaccaaaggcagctcaactgtcta |
50743366 |
T |
 |
| Q |
101 |
cttctgcagaaggatctctcggcaagttggtggaaaatattaattctgaaaatcagttggcttgtggctttggtcaactggtttccgatgataacaacag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50743367 |
cttctgcagaaggatctctcggcaagttggtggaaaatattaattctgaaaatcagttggcttgtggctctggtcaactggtttccgatgataacaacag |
50743466 |
T |
 |
| Q |
201 |
aaaaagtaaagttgggtctgtat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50743467 |
aaaaagtaaagttgggtctgtat |
50743489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University