View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8955_low_32 (Length: 208)
Name: NF8955_low_32
Description: NF8955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8955_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 71 - 194
Target Start/End: Complemental strand, 23414469 - 23414346
Alignment:
| Q |
71 |
gttctttaaccattgcaataaaattattatcattatcatgtgagggcatgtgtgtttccagtagtcctacaaaaatgaagttctttttatgtaattcaat |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23414469 |
gttctttaaccattgcaataaaattattatcattatcatgtgagggcatgtgtgtttccagtagtcctacaaaaatgaagttctttttatgtaattcaat |
23414370 |
T |
 |
| Q |
171 |
tttacgatatatagacagaataat |
194 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
23414369 |
tttacgatatatagacagaataat |
23414346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University