View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8955_low_32 (Length: 208)

Name: NF8955_low_32
Description: NF8955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8955_low_32
NF8955_low_32
[»] chr8 (1 HSPs)
chr8 (71-194)||(23414346-23414469)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 71 - 194
Target Start/End: Complemental strand, 23414469 - 23414346
Alignment:
71 gttctttaaccattgcaataaaattattatcattatcatgtgagggcatgtgtgtttccagtagtcctacaaaaatgaagttctttttatgtaattcaat 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23414469 gttctttaaccattgcaataaaattattatcattatcatgtgagggcatgtgtgtttccagtagtcctacaaaaatgaagttctttttatgtaattcaat 23414370  T
171 tttacgatatatagacagaataat 194  Q
    ||||||||||||||||||||||||    
23414369 tttacgatatatagacagaataat 23414346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University