View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8956_low_4 (Length: 537)
Name: NF8956_low_4
Description: NF8956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8956_low_4 |
 |  |
|
| [»] scaffold0856 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0856 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 260 - 479
Target Start/End: Original strand, 3491 - 3710
Alignment:
| Q |
260 |
atttgttacagacagaataattaggataagataacacaattccgaattacagatgaaagataagagatttagaaaatctacaaatttaaatcaagatatc |
359 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3491 |
atttgctacagacagaataattaggataagataacacaattccgaattacagatgaaagataagagatttagaaaatctacaaatttaaatcaagatatc |
3590 |
T |
 |
| Q |
360 |
atgctatcggtcggagacaatttcaaactggctatgatcattccttaactgcccctctcaagctagaggatggtttgactactcctagcttgttccttag |
459 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3591 |
atgctatcggtcggagacaatttcaaactggctatgatcattccttaactgcccctctcaagctagaggatggtttgactactcctagcttgttccttag |
3690 |
T |
 |
| Q |
460 |
ctgactaaacttcgtggttg |
479 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
3691 |
ctgactaaacttcatggttg |
3710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0856; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 3297 - 3497
Alignment:
| Q |
19 |
attctgggaccatcttactccatttcactttgtttcataagaagggatctttcaatttcaaatatgataatatactcaatgaagaggttcctaagtccac |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3297 |
attctgggaccatcttactccattgcactttgtttcataagaagggatctttcaatttcaaatatgataatatactcaatgaagaggttcctaagtccac |
3396 |
T |
 |
| Q |
119 |
tcactaacggacttcccatttcaagggcaactaaaggagtaatatattctacaagatagaaaaaactgaaggctggattaatcatataaatgctatttgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3397 |
tcactaacggacttcccatttcaagggcaactaaaggagtaatatattctacaagatagaaaaaactgaaggctggattaatcatataaatgctatttgc |
3496 |
T |
 |
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
3497 |
t |
3497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0856; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 475 - 523
Target Start/End: Original strand, 3748 - 3796
Alignment:
| Q |
475 |
ggttggaccataggctatagtcacgttattactcaacaactgatctctg |
523 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3748 |
ggttggaccataggctatagtcgcgttattactcaacaactgatctctg |
3796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University