View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8957_high_34 (Length: 261)
Name: NF8957_high_34
Description: NF8957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8957_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 43 - 193
Target Start/End: Original strand, 3590324 - 3590474
Alignment:
| Q |
43 |
ttctttataatagttgcgagtatgtctttgactagtggtacatatggattggaaaattaaatgagtattatgtcggaagtaatacattgactaagggaaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590324 |
ttctttataatagttgcgagtatgtctttgactagtggtacatatggattggaaaattaaatgagtattatgtcggaagtaatacattgactaagggaaa |
3590423 |
T |
 |
| Q |
143 |
atttattccctaatagggacatatttgattatttttaaaaaatacatatta |
193 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590424 |
atttattctctaatagggacatatttgattatttttaaaaaatacatatta |
3590474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University