View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8957_high_43 (Length: 202)
Name: NF8957_high_43
Description: NF8957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8957_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 17 - 133
Target Start/End: Complemental strand, 47659416 - 47659300
Alignment:
| Q |
17 |
tggaggtgaataaattatatcnnnnnnnnnnccttccccatcccaactgaatccatgccactggttgcaccttgagcatgatgagtgggtatagaagcaa |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47659416 |
tggaggtgaataaattatatcttttttttttccttccccatcccaactgaatccatgccactgattgcaccttgagcatgatgagtgggtatagaagcaa |
47659317 |
T |
 |
| Q |
117 |
ggacaaatcagggggag |
133 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47659316 |
ggacaaatcagggggag |
47659300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University