View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8957_low_80 (Length: 255)
Name: NF8957_low_80
Description: NF8957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8957_low_80 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 241
Target Start/End: Complemental strand, 27043472 - 27043242
Alignment:
| Q |
11 |
gtttggtgttgcggcgttgttttgtttacagttactgcagggtatttaccgtttaatgattataatgttactgtgctttatagaaaaatttaccgtggtc |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27043472 |
gtttggtcttgcggcgttgttttgtttactgttactgcagggtatttaccgtttaatgattataatgttactgtgctttatagaaaaatttaccgtggtc |
27043373 |
T |
|
| Q |
111 |
aatttcggtttccaaaatggatgtcatgtgatctgaagaatctcttatcacgtatgttggatacaaatcccaagacgaggattagtgttgatgagattct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27043372 |
aatttcggtttccaaaatggatgtcatgtgatctgaagaatctcttatcacgtatgttggatacaaatcccaagacgaggataagtgttgatgagattct |
27043273 |
T |
|
| Q |
211 |
tgaagacccgtggttcagctcgggtggatac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27043272 |
tgaagacccgtggttcagctcgggtggatac |
27043242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University