View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8957_low_80 (Length: 255)

Name: NF8957_low_80
Description: NF8957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8957_low_80
NF8957_low_80
[»] chr7 (1 HSPs)
chr7 (11-241)||(27043242-27043472)


Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 241
Target Start/End: Complemental strand, 27043472 - 27043242
Alignment:
11 gtttggtgttgcggcgttgttttgtttacagttactgcagggtatttaccgtttaatgattataatgttactgtgctttatagaaaaatttaccgtggtc 110  Q
    ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27043472 gtttggtcttgcggcgttgttttgtttactgttactgcagggtatttaccgtttaatgattataatgttactgtgctttatagaaaaatttaccgtggtc 27043373  T
111 aatttcggtttccaaaatggatgtcatgtgatctgaagaatctcttatcacgtatgttggatacaaatcccaagacgaggattagtgttgatgagattct 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
27043372 aatttcggtttccaaaatggatgtcatgtgatctgaagaatctcttatcacgtatgttggatacaaatcccaagacgaggataagtgttgatgagattct 27043273  T
211 tgaagacccgtggttcagctcgggtggatac 241  Q
    |||||||||||||||||||||||||||||||    
27043272 tgaagacccgtggttcagctcgggtggatac 27043242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University