View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8957_low_89 (Length: 218)
Name: NF8957_low_89
Description: NF8957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8957_low_89 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 10 - 203
Target Start/End: Complemental strand, 2346000 - 2345810
Alignment:
| Q |
10 |
aagcagagaccaaaagtcatgataaaaaacatttaggagatcaaaacttggtnnnnnnnnnntttaggggggtcaaaaacgaaatttgagatttttatag |
109 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2346000 |
aagcagagaccaaaagtcgtgataaaaaacatttaggagatcaaaacttggtaaaaaaaa---ttaggggggtcaaaaacgaaatttgagatttttatag |
2345904 |
T |
 |
| Q |
110 |
ggatcaaaggtcttattaaaccctaaaacaaattactctaaggttacgttgttttaaggaaacaacaataataaatagatatcttttattttct |
203 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
2345903 |
ggatttaaagtcttattaaaccctaaaacaaattactctaaggttacattgctttaaggaaacaacaatgataagtagatatcttttattttct |
2345810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University