View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8957_low_92 (Length: 212)

Name: NF8957_low_92
Description: NF8957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8957_low_92
NF8957_low_92
[»] chr1 (1 HSPs)
chr1 (144-198)||(38031299-38031353)


Alignment Details
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 144 - 198
Target Start/End: Original strand, 38031299 - 38031353
Alignment:
144 tgaggctgttcaaatatcatggtcctaatatataattgaaattaattagtataat 198  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
38031299 tgagggtgttcaaatatcatggtcctaatatataattgaaattaattagtataat 38031353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University