View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8957_low_96 (Length: 202)
Name: NF8957_low_96
Description: NF8957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8957_low_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 14361821 - 14361992
Alignment:
| Q |
18 |
gaacccaacgtggctaaatgaatataccaaagtggtgcaaaccaaaatggtttggctaagacattgtactttctgcctgatccaaagaggatgattattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14361821 |
gaacccaacgtggctaaatgaatataccaaagtggtgcaaaccaaaatggtttggctaagacattgtactttctgcctgatccaaagaggatgattattg |
14361920 |
T |
 |
| Q |
118 |
tcaatgtgagagcaattggaattgcaattcctatacctagggaacgtagtgctctcttagcttttgatctct |
189 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14361921 |
tcaatgtgagagcaatgggaattgcaattcctatacctagggaacgtagtgctctcttagcttttgatctct |
14361992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University