View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8958_low_14 (Length: 371)
Name: NF8958_low_14
Description: NF8958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8958_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 15 - 358
Target Start/End: Complemental strand, 44799851 - 44799508
Alignment:
| Q |
15 |
agaattatattaactctttgtttccatgaaagaacaaatgaagaacttaaattcctatgcagaactttatcaaggcttccatttggtagatactcataaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44799851 |
agaattatattaactctttgtttccatgaaagaacaaatgaagaacttaaattcctatgcagaactttatcaaggcttccatttggtagatactcataaa |
44799752 |
T |
 |
| Q |
115 |
ccaaaaccaattcattcccttcacaacaccaccctttaagctgaaccagattcttgtgccgcaagcaacctaccattgtagcgaactcggttgcaaaagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44799751 |
ccaaaaccaattcattcccttcacaacaccaccctttaagctgaaccagattcttgtgccgcaagcaacctaccattgtagcgaactcggttgcaaaagg |
44799652 |
T |
 |
| Q |
215 |
attgtgtaagcggtccaattcatcgattttttcgaatctcttgacagctacatcacctccaaatggaagtgaccctttataaacttttgctgatgcccct |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44799651 |
attgtgtaagcgatccaattcatcgattttttcgaatctcttgacagctacatcacctccaaatggaagtgaccctttataaacttttgctgatgcacct |
44799552 |
T |
 |
| Q |
315 |
tcaccaactagtctatctctattaaatcccattgtagctgatgt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44799551 |
tcaccaactagtctatctctattaaatcccattgtagctgatgt |
44799508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 149 - 219
Target Start/End: Original strand, 8349624 - 8349694
Alignment:
| Q |
149 |
tttaagctgaaccagattcttgtgccgcaagcaacctaccattgtagcgaactcggttgcaaaaggattgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||| ||| ||||||||||| || ||||||| |
|
|
| T |
8349624 |
tttaagctgaaccagattcttgtgccgcaagcaaccaatcattgaagcaaactcggttgcgaacggattgt |
8349694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University